ID: 1200278643_1200278650

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1200278643 1200278650
Species Human (GRCh38) Human (GRCh38)
Location X:154757891-154757913 X:154757943-154757965
Sequence CCCCTGAACCTGAGCAGGCTTGT ATGGCATGATGAGACTTCCAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!