ID: 1200297281_1200297289

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1200297281 1200297289
Species Human (GRCh38) Human (GRCh38)
Location X:154933310-154933332 X:154933361-154933383
Sequence CCTTGGAGACACCTCAGCTGTCA ATAAGCTATCTGGCCAAGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 212} {0: 1, 1: 0, 2: 3, 3: 6, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!