ID: 1200302772_1200302784

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1200302772 1200302784
Species Human (GRCh38) Human (GRCh38)
Location X:154995201-154995223 X:154995220-154995242
Sequence CCTTTTTCCCAAGGCTCACGTTG GTTGTGGTGGGGGCAGGGGCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!