ID: 1200326109_1200326117

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1200326109 1200326117
Species Human (GRCh38) Human (GRCh38)
Location X:155241548-155241570 X:155241576-155241598
Sequence CCTGCTCCCCCTACCCATCCTCT ATAAAGACACTGACATCTGTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!