ID: 1200369896_1200369902

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1200369896 1200369902
Species Human (GRCh38) Human (GRCh38)
Location X:155714584-155714606 X:155714614-155714636
Sequence CCACCACTAGAGGAACTGTGCTG CCTGAAGCCAGAACAGCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 221} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!