ID: 1200418252_1200418259

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1200418252 1200418259
Species Human (GRCh38) Human (GRCh38)
Location Y:2935431-2935453 Y:2935454-2935476
Sequence CCCGCACATCCGTCGGGTGAGTC CCGCGTGCCCCCGCGGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 36} {0: 1, 1: 0, 2: 4, 3: 22, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!