ID: 1200457858_1200457863

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1200457858 1200457863
Species Human (GRCh38) Human (GRCh38)
Location Y:3414729-3414751 Y:3414767-3414789
Sequence CCTCCTCTTGTTACCAGAGCTCA TCAGGCTTTCCTGACATCATAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 13, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!