ID: 1200457859_1200457861

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1200457859 1200457861
Species Human (GRCh38) Human (GRCh38)
Location Y:3414732-3414754 Y:3414749-3414771
Sequence CCTCTTGTTACCAGAGCTCAAAA TCAAAATAATTCCTCTTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 152} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!