ID: 1200513590_1200513598

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1200513590 1200513598
Species Human (GRCh38) Human (GRCh38)
Location Y:4112027-4112049 Y:4112078-4112100
Sequence CCACAGTCTGAAGGTCCAAGAAC AAGATGGCTATTCCAGCTCAAGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 5, 3: 38, 4: 231} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!