ID: 1200521268_1200521272

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1200521268 1200521272
Species Human (GRCh38) Human (GRCh38)
Location Y:4211998-4212020 Y:4212037-4212059
Sequence CCTGAAATCTTCTGCAGATAACT ACAGCTCTTGGCCTGTTACTGGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 218, 3: 192, 4: 323} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!