ID: 1200534459_1200534465

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1200534459 1200534465
Species Human (GRCh38) Human (GRCh38)
Location Y:4377409-4377431 Y:4377448-4377470
Sequence CCCTCTTCCTTGAAGAACTCCAT CATTTAAGAAAGTTAAAAACTGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 6, 3: 32, 4: 330} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!