ID: 1200607916_1200607928

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1200607916 1200607928
Species Human (GRCh38) Human (GRCh38)
Location Y:5289494-5289516 Y:5289542-5289564
Sequence CCAGGGCTTTCAGAGGAAAGCAT GGTGCACTCCAGGATCTGAGGGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 2, 3: 13, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!