ID: 1200623583_1200623584

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1200623583 1200623584
Species Human (GRCh38) Human (GRCh38)
Location Y:5483591-5483613 Y:5483626-5483648
Sequence CCTTTCTCTTAAGCTCAATGCTA ATTAAAGCCAGAATCCATGTAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 9, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!