ID: 1200648005_1200648007

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1200648005 1200648007
Species Human (GRCh38) Human (GRCh38)
Location Y:5809498-5809520 Y:5809522-5809544
Sequence CCTTCAGGATTCATTTTCGCAGC TGTGGCACAAGCCTGCAAGATGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 3, 3: 14, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!