ID: 1200649041_1200649049

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1200649041 1200649049
Species Human (GRCh38) Human (GRCh38)
Location Y:5817925-5817947 Y:5817975-5817997
Sequence CCCTTCAAGGCAGCAGGTTTTCT CCAGGATCTAGGGCCTGGAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!