ID: 1200686447_1200686456

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1200686447 1200686456
Species Human (GRCh38) Human (GRCh38)
Location Y:6263911-6263933 Y:6263948-6263970
Sequence CCACCGGTAACCGGGATGGCTGA CAGATCAAGGAGAAAGAGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 9, 2: 5, 3: 82, 4: 756}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!