ID: 1200728356_1200728359

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1200728356 1200728359
Species Human (GRCh38) Human (GRCh38)
Location Y:6702045-6702067 Y:6702066-6702088
Sequence CCCTCTCAGTGCTCTGAGGGCGA GAAGGCTCCTCTCCCATTTGAGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 1, 3: 13, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!