ID: 1200731977_1200731984

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1200731977 1200731984
Species Human (GRCh38) Human (GRCh38)
Location Y:6752540-6752562 Y:6752579-6752601
Sequence CCTCCTAATAGGGGCTGATATCT CTGTCCATAAATCCCTGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 52} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!