ID: 1200732569_1200732572

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1200732569 1200732572
Species Human (GRCh38) Human (GRCh38)
Location Y:6758398-6758420 Y:6758416-6758438
Sequence CCCAGTTTGAACTTCCTGGCTGC GCTGCTTTGTTTACACTGTGAGG
Strand - +
Off-target summary No data {0: 10, 1: 236, 2: 552, 3: 440, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!