ID: 1200784645_1200784649

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1200784645 1200784649
Species Human (GRCh38) Human (GRCh38)
Location Y:7249403-7249425 Y:7249436-7249458
Sequence CCAAGGATGCTCAAGCCCCTTGT GCAGTATTTGCATATCACCCAGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 51, 3: 180, 4: 628} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!