ID: 1200854861_1200854864

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1200854861 1200854864
Species Human (GRCh38) Human (GRCh38)
Location Y:7926542-7926564 Y:7926579-7926601
Sequence CCATGTCAAATGTGAACAGGGTT GAGTCACACAACCTAGATGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 16, 3: 110, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!