ID: 1200857856_1200857866

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1200857856 1200857866
Species Human (GRCh38) Human (GRCh38)
Location Y:7958802-7958824 Y:7958831-7958853
Sequence CCTATCCTGTGGTGGAGGTGGAC TGTACTGGGACAGGAGGAGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 51, 4: 602}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!