ID: 1200862343_1200862347

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1200862343 1200862347
Species Human (GRCh38) Human (GRCh38)
Location Y:8006375-8006397 Y:8006420-8006442
Sequence CCCAAACAAGAAATTCATATCAT CTAAAATTACCAAAGGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 2, 3: 48, 4: 432} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!