ID: 1200862808_1200862815

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1200862808 1200862815
Species Human (GRCh38) Human (GRCh38)
Location Y:8010845-8010867 Y:8010891-8010913
Sequence CCAGTTAGATGTCACAATCCACC GAGTCACACTACCTGGATACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 37, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!