ID: 1200869386_1200869387

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1200869386 1200869387
Species Human (GRCh38) Human (GRCh38)
Location Y:8081117-8081139 Y:8081131-8081153
Sequence CCTCAAATAATATGTCACCAAGT TCACCAAGTCTGCTATAGACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 45, 4: 315} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!