ID: 1200871083_1200871085

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1200871083 1200871085
Species Human (GRCh38) Human (GRCh38)
Location Y:8099141-8099163 Y:8099170-8099192
Sequence CCTGCTATTGGTCTACTGAGAGA TTCCTTCTGGTTTAATTATTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!