ID: 1200921947_1200921955

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1200921947 1200921955
Species Human (GRCh38) Human (GRCh38)
Location Y:8621016-8621038 Y:8621057-8621079
Sequence CCACCTGGGGTTTCCTGCAGAAC GCCAGGCTCCGTGTTTTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 47, 4: 307} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!