ID: 1200925302_1200925304

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1200925302 1200925304
Species Human (GRCh38) Human (GRCh38)
Location Y:8648958-8648980 Y:8648985-8649007
Sequence CCAAGCGCATGGAGCATTATAAA AAGGTCCTGTTAAACTCTGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!