ID: 1200927542_1200927544

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1200927542 1200927544
Species Human (GRCh38) Human (GRCh38)
Location Y:8668101-8668123 Y:8668118-8668140
Sequence CCAAGAAAAAAACTCTCAGTCTC AGTCTCCCGCTTCTATGTAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 4, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!