ID: 1200970753_1200970758

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1200970753 1200970758
Species Human (GRCh38) Human (GRCh38)
Location Y:9150077-9150099 Y:9150127-9150149
Sequence CCCACCAAGTTTTAAATTGTAGG GTAAGAGCATCTCAGTCAGTAGG
Strand - +
Off-target summary No data {0: 4, 1: 25, 2: 24, 3: 46, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!