ID: 1200970842_1200970854

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1200970842 1200970854
Species Human (GRCh38) Human (GRCh38)
Location Y:9150811-9150833 Y:9150850-9150872
Sequence CCACTTGCCAAGACCAGCTCAGT CAGTGGTGCTAGAGGAATTAAGG
Strand - +
Off-target summary {0: 8, 1: 30, 2: 49, 3: 79, 4: 187} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!