ID: 1200990298_1200990302

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1200990298 1200990302
Species Human (GRCh38) Human (GRCh38)
Location Y:9339506-9339528 Y:9339535-9339557
Sequence CCTTGAGAGGAAGACAGAGAGTG TCCAGGACGTTCATGGCATTGGG
Strand - +
Off-target summary {0: 8, 1: 5, 2: 4, 3: 50, 4: 427} {0: 9, 1: 1, 2: 3, 3: 6, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!