ID: 1201003452_1201003456

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1201003452 1201003456
Species Human (GRCh38) Human (GRCh38)
Location Y:9489288-9489310 Y:9489331-9489353
Sequence CCTTTCGTACATGTAGAAATTCC GACAGAATCCAGGACGTTCATGG
Strand - +
Off-target summary {0: 9, 1: 4, 2: 2, 3: 9, 4: 76} {0: 9, 1: 2, 2: 2, 3: 10, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!