ID: 1201030586_1201030592

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1201030586 1201030592
Species Human (GRCh38) Human (GRCh38)
Location Y:9742484-9742506 Y:9742512-9742534
Sequence CCAGCAACAGGGAAACTTTTGTT ACCGTTATCAGAGGGCTGCAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 23, 4: 244} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!