ID: 1201034548_1201034552

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1201034548 1201034552
Species Human (GRCh38) Human (GRCh38)
Location Y:9774126-9774148 Y:9774144-9774166
Sequence CCTTCTCCAGCATGACATGGCCA GGCCATGGAGATGCCATGAAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 36, 4: 259} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!