ID: 1201059217_1201059221

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1201059217 1201059221
Species Human (GRCh38) Human (GRCh38)
Location Y:10029495-10029517 Y:10029510-10029532
Sequence CCCAGGCAAATTTTTTTGTACCT TTGTACCTTTAGGAGAGACAGGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 3, 3: 57, 4: 924} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!