ID: 1201066956_1201066965

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1201066956 1201066965
Species Human (GRCh38) Human (GRCh38)
Location Y:10106194-10106216 Y:10106232-10106254
Sequence CCTCCACTCCCACCTAGCAGCAG AAACCAGTGAATTTGGGAGAGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 6, 3: 44, 4: 443} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!