ID: 1201147891_1201147899

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1201147891 1201147899
Species Human (GRCh38) Human (GRCh38)
Location Y:11075448-11075470 Y:11075494-11075516
Sequence CCCATCTCACAGTTCTGCAGAAA AGTGACATGCCCAAGGTAAAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!