ID: 1201160469_1201160474

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1201160469 1201160474
Species Human (GRCh38) Human (GRCh38)
Location Y:11161059-11161081 Y:11161079-11161101
Sequence CCTGCCAGCTGCAAAATCCCAAA AAAGCCCCCAGCCCTCTCATGGG
Strand - +
Off-target summary No data {0: 5, 1: 1, 2: 0, 3: 18, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!