ID: 1201244369_1201244372

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1201244369 1201244372
Species Human (GRCh38) Human (GRCh38)
Location Y:11988404-11988426 Y:11988429-11988451
Sequence CCAGAAACTTCTCTGCAGTATCT CTTGTCCATCTGGTCTAAGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 24, 4: 280} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!