ID: 1201251272_1201251274

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1201251272 1201251274
Species Human (GRCh38) Human (GRCh38)
Location Y:12060510-12060532 Y:12060537-12060559
Sequence CCAATACTAAACCAGGAAGAAGT TATCTGAACAGATCAATAGCAGG
Strand - +
Off-target summary {0: 38, 1: 8084, 2: 3969, 3: 2105, 4: 2282} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!