ID: 1201292869_1201292875

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1201292869 1201292875
Species Human (GRCh38) Human (GRCh38)
Location Y:12438951-12438973 Y:12438982-12439004
Sequence CCTTTCTGGTTTCCTTCGGGGAC GGTATGAGTTAGAGGGCCCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 9, 4: 115} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!