ID: 1201295281_1201295285

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1201295281 1201295285
Species Human (GRCh38) Human (GRCh38)
Location Y:12457027-12457049 Y:12457080-12457102
Sequence CCTAAATGTATATACACATATAC CAGTATGCATACATATATAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 19, 3: 175, 4: 1383} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!