ID: 1201315260_1201315266

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1201315260 1201315266
Species Human (GRCh38) Human (GRCh38)
Location Y:12639474-12639496 Y:12639509-12639531
Sequence CCTTGCTGATTCTAGTCAGTGTT CACAGGGAAATACCCAGGTTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 14, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!