ID: 1201327988_1201327993

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1201327988 1201327993
Species Human (GRCh38) Human (GRCh38)
Location Y:12786312-12786334 Y:12786355-12786377
Sequence CCAAGTTCTATACCTAACAGAGG AATGTAATTTTTATATTATACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 125} {0: 1, 1: 0, 2: 10, 3: 117, 4: 1233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!