ID: 1201376651_1201376662

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1201376651 1201376662
Species Human (GRCh38) Human (GRCh38)
Location Y:13330327-13330349 Y:13330374-13330396
Sequence CCCAGTTTATCTCACTGGGACTG GAGGGCAAACAGAAGCAGGGTGG
Strand - +
Off-target summary {0: 5, 1: 103, 2: 652, 3: 1081, 4: 1328} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!