ID: 1201389039_1201389045

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1201389039 1201389045
Species Human (GRCh38) Human (GRCh38)
Location Y:13477352-13477374 Y:13477396-13477418
Sequence CCTTCCACCTTCTCCAAAGAATG GAAACGCAGCCCCTTGATCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 40, 4: 412} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!