ID: 1201412404_1201412416

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1201412404 1201412416
Species Human (GRCh38) Human (GRCh38)
Location Y:13713412-13713434 Y:13713452-13713474
Sequence CCTTCTGCCTCTTCCTTGCTAGT GTCCAGGATGGGGGCGTGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 14, 2: 93, 3: 234, 4: 616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!