ID: 1201416495_1201416502

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1201416495 1201416502
Species Human (GRCh38) Human (GRCh38)
Location Y:13752932-13752954 Y:13752958-13752980
Sequence CCTGCGCGGAGGCTCTGGGTGCG GGGCACACTATGGCAGGTTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 118} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!