ID: 1201419457_1201419464

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1201419457 1201419464
Species Human (GRCh38) Human (GRCh38)
Location Y:13782446-13782468 Y:13782495-13782517
Sequence CCTCCTTGAGCTGCAGTGGGCTC TTGTTTACCTACTCAAGCCTGGG
Strand - +
Off-target summary No data {0: 408, 1: 745, 2: 2190, 3: 577, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!